Guidelines for the Laboratory Diagnosis of Mycoplasma genitalium Infections in East European Countries

Elena Shipitsyna1, Alevtina Savicheva1, Evgenij Sokolovskiy2, Ronald C. Ballard3, Marius Domeika4, Magnus Unemo5, Jörgen S. Jensen6 and EE SRH Network

1Microbiology Laboratory, DO Ott Research Institute of Obstetrics and Gynecology and 2Department of Dermatology and Venereology, Pavlov State Medical

University, St Petersburg, Russia, 3National Center for HIV, STD, and TB prevention, Centers for Disease Control and Prevention, Atlanta, GA, USA, 4Department of Medical Sciences, Uppsala University, Uppsala, 5Department of Laboratory Medicine, Clinical Microbiology, Örebro University Hospital, Örebro, Sweden, and 6Mycoplasma Laboratory, Statens Serum Institut, Copenhagen, Denmark

The present guidelines aim to provide comprehensive information regarding laboratory diagnosis of Mycoplasma genitalium infections in East European countries. These guidelines are intended primarily for laboratory professionals testing specimens from patients at sexual health care clinics, but may also be useful for community-based screening programmes. Diagnosis of M. genitalium infection is performed exclusively using nucleic acid amplification tests (NAATs), owing to the poor and slow growth of the bacterium in culture. Because no internationally validated and approved commercial NAAT for M. genitalium detection is presently available, it is necessary that laboratories performing M. genitalium diagnostics not only carefully evaluate and validate their in-house PCRs before using them routinely, but also use comprehensive internal controls and take part in external quality assessment programmes. The guidelines were elaborated as a consensus document of the Eastern European Sexual and Reproductive Health Network, and comprise one element of a series of guidelines aimed at optimizing, standardizing, and providing guidance on quality laboratory testing for reproductive tract infections. Key words: Mycoplasma genitalium; laboratory diagnosis; guidelines; Eastern Europe.

(Accepted May 7, 2010.)

Acta Derm Venereol 2010; 90: 461–467.

Magnus Unemo, National Reference Laboratory for Pathogenic Neisseria, Örebro University Hospital, SE-70185 Örebro, Sweden. E-mail: magnus.unemo@orebroll.se

Mycoplasma genitalium is a relatively newly discovered microorganism, which was first isolated in 1980 from two of 13 men with non-gonococcal urethritis (1). M. genitalium is a very fastidious bacterium, and cultivation of this organism is exceedingly difficult and time-consuming; therefore data regarding its clinical relevance have become available only after introduction of PCR assays (2, 3). With the use of PCR tests, it has been shown that M. genitalium is a sexually transmitted pathogen and that the spectrum of diseases in both males and females is similar to that caused by Chlamydia trachomatis and Neisseria gonorrhoeae (4).

In Eastern Europe, the true incidence and prevalence of most sexually transmitted infections (STIs), including M. genitalium infection, remain unknown. This situation results primarily from suboptimal diagnostics, case reporting and surveillance systems (5–11). The present guidelines are the most recent in a series of guidelines (12–15) developed by the Eastern European Sexual and Reproductive Health (EE SRH) Network (11, 16, 17) aimed at establishing quality laboratory testing for STIs in East European countries. It is envisaged that different countries may need to make minor national adjustments to the guidelines presented here in order to meet local laws, health strategies and the availability of kits and reagents.

CLINICAL PRESENTATION OF M. GENITALIUM INFECTIONS

Considerable evidence has accumulated in recent years to suggest that M. genitalium has an aetiological role in urethritis in males (4). An association and/or suggestive evidence have been demonstrated, but a causal role of M. genitalium has not been proven for:

cervicitis in females (18–21),
pelvic inflammatory disease (22),
prostatitis (23),
epididymitis (24),
tubal factor infertility (25, 26),
sexually acquired reactive arthritis (27, 28).

Lack of a clear association with M. genitalium has been reported for:

bacterial vaginosis (3, 19, 29),
adverse pregnancy outcomes (30, 31).

LABORATORY DIAGNOSIS OF M. GENITALIUM INFECTIONS

Although culture techniques have improved in recent years, it takes several weeks or even months for each isolate to grow (32, 34), which makes culture impossible to use for diagnostics in routine clinical practice.

M. genitalium shares several structural properties with another human pathogen, M. pneumoniae, and cross-reactivity between these two Mycoplasma species can result in lack of adequate specificity when using serology for diagnosis (35). Recently, several techniques have been developed and some have shown usefulness in epidemiological studies (25, 36); however, none of the available tests have been validated for use in the diagnosis of individual cases.

Since traditional diagnostic methods, such as culture and serology, are not suitable for routine diagnosis of M. genitalium, identification of infected individuals has been entirely dependent on nucleic acid amplification tests (NAATs). Table I presents M. genitalium NAATs used in published studies.

Table I. Published diagnostic PCR tests for M. genitalium. Positions with sequence variation in bold

Target gene and PCR assay methodology	Forward primer			Reverse primer			Ref.
Target gene and PCR assay methodology	Name	Sequence	Position	Name	Sequence	Position	Ref.
MgPa Conventional PCR	MgPa-1	AGTTGATGAAACCTTAACCCCTTGG 1 mismatch in 1 strain	180–204	MgPa-3	CCGTTGAGGGGTTTTCCATTTTTGC 0 mismatches	436–460	(2)
MgPa Conventional PCR (semi-nested)	Mg1 (outer f)	TGTCTATGACCAGTATGTAC 1 mismatch in 3 strains	3837–3856	Mg2 (outer r)	CTGCTTTGGTCAAGACATCA 1 mismatch in 6 strains	4191–4210	(3)
MgPa Conventional PCR (semi-nested)	Mg3 (inner f)	GTAATTAGTTACTCAGTAGA 0 mismatches	3910–3929	Mg2 (outer r)	CTGCTTTGGTCAAGACATCA 1 mismatch in 6 strains	4191–4210	(3)
MgPa Conventional PCR (semi-nested)	Mg1a (outer f)	GGTTAACTTACCtaAGTGGCTTTGATC 1 mismatch in 5 strains	3864–3889	Mg2	Same as (3)		(37)
MgPa Conventional PCR (semi-nested)	Mg3	Same as (3)	3864–3889	Mg2	Same as (3)		(37)
MgPa Conventional PCR	G3A	GCTTTAAACCTGGTAACCAGATTGACT 1 mismatch in 1 strain	3755–3781	G3B	GAGCGTTAGAGATCCCTGTTCTGTTA 0 mismatches	4236–4261	(38)
MgPa Conventional PCR	MgPaW1	AAGTGGAGCGATCATTACTAAC 0 mismatches	–85– –63	MgPaWR1	CCGTTGTTATCATACCTTCTGA 0 mismatches	389–410	(39)
MgPa Conventional PCR (semi-nested)	MGS-1	GAGCCTTTCTAACCGCTGC 0 mismatches	38–56	MGS-4	GTTGTTATCATACCTTCTGAT 0 mismatches	388–408	(40)
MgPa Conventional PCR (semi-nested)	MGS-1	GAGCCTTTCTAACCGCTGC 0 mismatches	38–56	MGS-2	GTGGGGTTGAAGGATGATTG Up to 10 mismatches in 11 strains	691–710	(40)
MgPa Conventional PCR	MgPa-1-mod	TGAAACCTTAACCCCTTGG 1 mismatch in 1 strain	186–204	MgPa-3-mod	AGGGGTTTTCCATTTTTGC 0 mismatches	436–454	(41) from (2)
MgPa Conventional PCR	MgPa-476	ATGGCGAGCCTATCTTTGATCCTTTTAA 1 mismatch in 2 strains	476–503	MgPa-903	TTCACCTCCCCACTACTGTtaCTTATGC Up to 15 mismatches in 15 strains	903–929	(42)
MgPa Conventional PCR (microplate hybridization)	MgPa-1-mod	Same as (41)		MgPa-1-mod	Same as (41)		(43) from (41)
MgPa Real-Time PCR (TaqMan)	MgPa-355F	GAGAAATACCTTGATGGTCAGCAAb 1 mismatch in 1 strain	355–378	MgPa-432R	GTTAATATCATATAAAGCTCTACCGTTGTTATC 0 mismatches	400–432	(44)
16S rRNA Conventional PCR	Mge 1	GAATGACTCTAGCAGGCAATGGCTG	451–475	Mge 2	ATTTGCTCACTTTTACAAGTTGGCT	1236–1260	(45)
16S rRNA Conventional PCR (microplate hybridization)	Mg16S-45F	TACATGCAAGTCGATCGGAAGTAGC	57–81	Mg16S-447R	AAACTCCAGCCATTGCCTGCTAG	459–481	(46)
16S rRNA Conventional PCR	16SFG2	CCTTATCGTTAGTTACATTGTTTAA	1108–1132	16SRG	TGACATGCGCTTCCAATAAA 1 mismatch with 16S rRNA SNP (47)	1429–1448	(48)
16S rRNA Conventional PCR	My-ins	GTAATACATAGGTCGCAAGCGTTATC	532-557	MGSO	TGCACCATCTGTCACTCTGTTAACCTC	1024-1050	(49)
16S rRNA Conventional PCR (microplate hybridization)	My-ins	Same as (49)		MGSO-2	CACCATCTGTCACTCTGTTAACCTC	1026-1050	(50)
16S rRNA Real-time PCR (TaqMan)	My-ins	Same as (49)		MGSO-2	Same as (50)		(51)
16S rRNA Real-time PCR (FRET probes)	Mg16S-45F	Same as (46)		Mg16S-447R	Same as (46)		(52)
16S rRNA Real-time PCR (FRET probes)	Mg16S-45F	Same as (46)		Mg16S-447R	Same as (46)	adapted to real-time PCR from (46)
P115 (MG298) Real-Time PCR (FRET probes)	p115-f	CCCATCGTCAAGGTACAATGATGA	2817–2840	p115-r	GCATTTTCAAGTTCAACTGCAAAGG	2892–2916	(53)
gap (MG301) Real-time PCR (FRET probes)	Mg-gap-605f	GTGCTCGTGCTGCAGCTGT	605–623	mg-gap-794r	GCTTGATTTACTTGTTCAACAGATGGAC	767–794	(54)

aThe nucleotide is misprinted according to M. genitalium G37 sequence in the original publication.bUnderlined variation was reported in additional sequences, but this has been shown not to influence amplification efficiency (44).

Most of the PCR assays are based on detection of sequences within the MgPa adhesin gene of M. genitalium. Some parts of the MgPa gene, however, are highly variable and primers targeting these regions will not perform well with clinical specimens. In Table I, the maximal number of mismatches found with a single M. genitalium strain in the target region is given for each MgPa gene primer aligned with 22 known sequences. These sequences (n = 22) were obtained from the seven M. genitalium strains deposited in the ATCC with known high sequence homology to the G37 type strain, from an early passage of the M30 strain isolated by David Taylor-Robinson in 1980 (1), from three consecutive isolates from a French patient, and from 11 unrelated M. genitalium strains isolated from patients from Scandinavia and Japan.

The 16S rRNA gene is also used as target in M. genitalium PCRs (46, 48, 52); however, owing to the homology between M. genitalium and M. pneumoniae, design of specific and sensitive primers and probes is relatively difficult (45). For some 16S rRNA gene PCR assays, detection of M. genitalium is based on amplification with Mollicutes (Mycoplasma and Ureaplasma) universal primers and subsequent hybridization with species specific probes (50, 51). Although this approach allows detection of several Mycoplasma species from the same primary amplification reaction, significant competition, in particular with amplification of ureaplasmal 16S rRNA gene sequences, can result in poor sensitivity for detection of M. genitalium DNA (55).

Several real-time M. genitalium PCR tests have been developed since the first real-time assay was published in 2002 by Yoshida et al. (51). The combination of high sensitivity, specificity, robustness and reduced risk of contamination with amplicons suggests that real-time PCR should be the main method for M. genitalium diagnostics in the future. Quantification of M. genitalium DNA, which is feasible using real-time PCR, may provide important information regarding a number of research questions such as treatment efficacy (53) or clinical relevance of M. genitalium DNA load in clinical specimens (44).

As an alternative to PCR, a transcription-mediated amplification (TMA) assay targeting the 16S rRNA, a molecule present in up to 100–1000 copies per bacterial cell, thereby increasing the sensitivity of detection compared with the PCR assays that target single-copy genes, has been offered recently (56). This NAAT was shown to be a sensitive, specific and high-throughput test for M. genitalium detection. In Russia, a nucleic acid sequence-based amplification (NASBA) assay (57) also targeting 16S rRNA is commercially available.

Although NAATs are the only effective tools available for detection of M. genitalium at present, and some are commercially available, no approved commercial NAAT is available. It is important to note, that for diagnostic use in the European Union, commercial tests need to be CE (Conformité Européenne) marked according to the In Vitro Diagnostic Medical Devices Directive 98/79/EC. However, in Article 1.5 of the Directive, devices “manufactured and used only within the same health institution and on the premises of their manufacture, or used on premises in the immediate vicinity, without having being transferred to another legal entity” are excluded. This allows in-house NAATs to be used for diagnostic purposes within the institution if this service is provided without a fee or as part of any commercial transaction, but even so, quality assurance is of utmost importance.

INDICATIONS FOR TESTING FOR M. GENITALIUM

The main indications for testing for M. genitalium are presented in Table II.

Table II. Clinical indications for testing for M. genitalium

Patients

Indications

Males

Urethritis (especially in urethritis after empirical doxycycline therapya)

Epididymitis

Prostatitis (with concurrent urethritis)

Sexual partners of M. genitalium positive patients

Females

Cervicitis

Urethritis

Pelvic inflammatory disease (PID)

Sexual partners of M. genitalium positive patients

aA substantial proportion of M. genitalium infected patients with urethritis have persistent infection and often experience recurrent symptoms after doxycycline therapy (53, 58).

At present, population screening for M. genitalium is considered premature because prospective data on the natural history of disease, as well as clear evidence regarding M. genitalium as a cause of severe complications and sequelae is lacking (59).

CLINICAL SAMPLES FOR TESTING

General

In recent years, many NAATs have been used to detect M. genitalium in patient specimens (Table I), and some studies have also assessed the sensitivities of different specimen types for the detection of M. genitalium (52, 56, 60–62). In one large study, male first voided urine (FVU) was found to detect more M. genitalium infections (98%) than urethral swabs (82%). In females, however, FVU detected only 71% of the M. genitalium infections, while using both FVU and a cervical swab specimen increased the sensitivity to 96% (60).

In a study by Wroblewski et al. (56), it was concluded that in women, the most sensitive specimen type for the detection of M. genitalium was a vaginal swab (84% of infections by TMA, 91% by PCR), followed by a cervical swab (60% by TMA, 53% by PCR) and urine (58% by TMA, 65% by PCR). Their findings that vaginal swab specimens are more sensitive than urine specimens for the detection of M. genitalium infection in women differ from those of Shipitsyna et al. (62), who showed that FVU was superior to both vaginal samples in females (100% vs. 57%) and to urethral swabs in males (83% vs. 75%) for the detection of infection.

Although the ideal genital specimen type for the detection of M. genitalium in men and women has not been thoroughly assessed, FVU seems to be the most sensitive specimen for the detection of M. genitalium infection in men, whereas in women, the use of more than one specimen may significantly improve the diagnostic sensitivity. In a recent study, endocervical swab specimens mixed and transported in FVU demonstrated a trend towards a higher sensitivity than FVU specimens alone as well as a significantly increased sensitivity compared with endocervical swab specimens transported in 2-SP medium for detection of M. genitalium DNA (61). It is important to note, however, that the ideal specimen type is highly dependent on the method applied for nucleic acid extraction and that the optimal specimen type may also differ between NAATs. Unfortunately, no systematic comparative studies on sample preparation before NAAT have been performed, but important issues to consider are: (i) sample collection without unnecessary volumes of transport medium, i.e. avoiding dilution of FVU specimen by mid-stream urine; (ii) concentration of the bacterial cells by centrifugation, and use of methods for purification that yield sufficiently clean nucleic acids without loss of target or excessive number of manipulations that would increase the risk of sample cross-contamination.

Sample collection, transportation and storage

The performance characteristics of the diagnostic tests are largely dependent upon the quality of the sampling. Even the best tests may give inadequate results owing to inappropriate sampling.

It is important to remember that:

specific therapy should not have been initiated prior to sampling;
if urethral and/or urine samples are collected, a patient should not have urinated for at least two hours prior to sampling.

Sampling devices:

gynaecological speculum;
cotton (gauze) swab to remove contaminating discharge;
sterile cotton/Dacron swab;
sterile container for urine;
tubes with transport medium.

Specimens are collected in transport medium supplied/recommended by the manufacturer of the specific NAAT. Ideally, sampling and transport should be identical to that for C. trachomatis NAAT detection as the same specimen is usually tested for both agents. If no transport medium is specified in the manufacturer’s instruction, samples may be collected in 2-SP medium (sucrose-phosphate buffer; 0.2 M sucrose, 0.02 M phosphate) according to the following procedures (Table III).

Table III. Methods of collection of specimens for detection of M. genitalium

Patients

Collection methods

Males

Urethral swab

In case of abundant discharge clean the external opening with a cotton (gauze) swab

Introduce a sampling swab into the urethral meatus (0.5–2 cm), slightly rotate the swab in the urethra for few seconds, then take it out and place into a tube with transport medium

First catch urine

Ask the patient to collect the first 5–10 ml of the freely voided urine without previous washing

Females

Cervical swab

Introduce warmed gynaecological speculum and clean the external cervical os to remove contaminating vaginal discharge using a large cotton (gauze) swab

Introduce a sampling swab into the endocervical canal (1–2 cm), slightly rotate the swab inside the endocervical canal, then take it out and place into a tube with transport medium

Urethral swab

In case of abundant discharge clean the external opening with a cotton (gauze) swab

Introduce a sampling swab into the urethral meatus (0.5–2 cm), slightly rotate the swab in the urethra for few seconds, then remove it and place into a tube with transport medium

Vaginal swab

Obtain material under direct vision using a gynaecological speculum from the posterior and lateral fornices of the vagina using a sterile swab, then place it into a tube with transport medium

Self-obtained vaginal swabs can be used in certain situations. Women are instructed to insert the swab approximately 5 cm into the vagina and rotate three times. The procedure should not elicit any pain. After retraction, the swab is placed in an appropriate transport medium

First catch urine

Ask the patient to collect the first 5–10 ml of the first voided urine without any previous washing

Sample transportation and storage:

clinical materials should be transported to the laboratory as soon as possible.
if storage conditions are not indicated in the manufacturer’s instruction, samples should be kept at room temperature for up to 6 h or in a refrigerator for up to one week. Freezing should be avoided if possible as it decreases the sensitivity in most transport media (unpublished data1).

1Carlsen KH, Jensen JS. Does freezing of specimens affect sensitivity? Submitted.

PCR-BASED DIAGNOSIS OF M. GENITALIUM INFECTION

Analysis procedures

All analysis procedures should be performed in accordance with the instructions of the manufacturer of the specific PCR, using equipment, reagents and disposables supplied/recommended. Each run should include all necessary quality controls: positive (amplification) control, negative (contamination) control, and inhibition control.

PCR tests used in East European countries for diagnosis of M. genitalium infection

The information regarding performance characteristics of NAATs used in East European countries for the detection of M. genitalium is limited, but an evaluation of some commercially available Russian PCRs has recently been published (62).

QUALITY ASSURANCE

At present, NAATs are the only tools available for M. genitalium detection. A quality assurance scheme for nucleic acid-based diagnostics is presented in Fig. 1.

Fig. 1. A quality assurance scheme in diagnostic microbiology using nucleic acid amplification tests.

Prior to implementation in routine diagnostics, methods should be fully evaluated and validated. General guidelines and the minimum requirements for validation of a new or modified test have been published (63, 64).

Based on these principles, for validation of a new test for M. genitalium infection, we recommend:

Validation of the proposed test against an internationally validated and published test;
A minimum of 50 positive clinical specimens and 100 negative specimens should be tested (as shown by the reference test);
Specimens that are weakly positive should be included. Replicate dilutions of a strong positive specimen should also be included to assess the reproducibility of detection at low copy number;
The sensitivity of the proposed test should not be more than 5% below that of the chosen reference test and the specificity should be > 99%.

Recently, a series of studies has been conducted in Russia to evaluate NAATs used for diagnosis of STIs, including M. genitalium infection (62, 65, 66). The diagnostic performance of the M. genitalium PCRs displayed a high level of concordance with the reference assays, but the results of the study indicated that only one of the five PCRs evaluated had a reasonable clinical sensitivity, whereas the specificities of all the tests were high.

RECOMMENDATIONS

A diagnosis of M. genitalium infection should be performed exclusively using NAATs, owing to the poor and slow growth of the bacterium in culture.
Since no internationally validated and approved commercial NAATs for M. genitalium detection are presently available, it is necessary that laboratories performing M. genitalium diagnostics carefully evaluate and validate in-house PCRs before using them in routine clinical practice. Comprehensive internal controls should be used and laboratories should participate in external quality assessment programmes.

ACKNOWLEDGEMENTS

The present guidelines were written on behalf of the Eastern European Sexual and Reproductive Health (EE SRH) Network, STI Diagnostic Group, which is supported by grants from the East Europe Committee of the Swedish Health Care Community, Swedish International Development Cooperation Agency (SIDA). Project coordinator Marius Domeika.

EE SRH Network: K. Babayan, E. Manukyan (Armenia), R. Ismailov (Azerbaijan), I. Shimanskaya, O. Pankratov, N. Kolomiets, O. Kudina (Belarus), K. Chudomirova (Bulgaria), T. Brilene (Estonia), G. Galdava, O. Kvlividze (Georgia), J. Deak (Hungary), G. Askarova, A. Utegenova (Kazakhstan), D. Yusupova, E. Al-Kilani (Kyrgyzstan), A. Rubins (Latvia), V. Kucinskiene (Lithuania), T. Krasnoselskikh, A. Guschin (Russia), A. Kasymov, O. Kasymov (Tajikistan), G. Mavrov, N. Kochetova, G. Bondarenko (Ukraine), S. Ibragimov, O. Izvekova, and T. Nabiev (Uzbekistan).

REFERENCES

Tully JG, Taylor-Robinson D, Cole RM, Rose DL. A newly discovered mycoplasma in the human urogenital tract. Lancet 1981; i: 1288–1291.

Jensen JS, Uldum SA, Søndergård-Andersen J, Vuust J, Lind K. Polymerase chain reaction for detection of Mycoplasma genitalium in clinical samples. J Clin Microbiol 1991; 29: 46–50.

Palmer HM, Gilroy CB, Furr PM, Taylor-Robinson D. Development and evaluation of the polymerase chain reaction to detect Mycoplasma genitalium. FEMS Microbiol Lett 1991; 61: 199–203.

Jensen JS. Mycoplasma genitalium: the aetiological agent of urethritis and other sexually transmitted diseases. J Eur Acad Dermatol Venereol 2004; 18: 1–11.

Domeika M, Litvinenko I, Smirnova T, Gaivaronskaya O, Savicheva A, Sokolovskiy E, et al. Laboratory diagnostics for non-viral sexually transmitted infections in St. Petersburg, Russia: current situation and hallmarks for improvements. J Eur Acad Dermatol Venereol 2008; 22: 1094–1100.

Naaber P, Uuskula A, Naaber J, Põder A, Hjelm E, Hallén A, et al. Laboratory diagnosis of sexually transmitted infections in Estonia in 2001–2002: shortcomings with impact on diagnostic quality and surveillance. Sex Transm Dis 2005; 32: 759–764.

Vagoras A, Butylkina R, Juseviciute V, Hallén A, Unemo M, Domeika M. Diagnosis of non-viral sexually transmitted infections in Lithuania and international recommendations. Euro Surveill 2006; 11: 161–164.

Shalepo K, Savicheva A, Shipitsyna E, Unemo M, Domeika M. Diagnosis of Chlamydia trachomatis in Russia – in-house PCR assays may be effective but overall optimization and quality assurance are urgently needed. APMIS 2006; 114: 500–507.

Unemo M, Savicheva A, Budilovskaya O, Sokolovsky E, Larsson M, Domeika M. Laboratory diagnosis of Neisseria gonorrhoeae in St. Petersburg, Russia: inventory, performance characteristics and recommended optimizations. Sex Transm Infect 2006; 82: 41–44.

Shipitsyna E, Guschin A, Maximova A, Tseslyuk M, Savicheva A, Sokolovsky E, et al. Comparison of microscopy, culture and in-house PCR and NASBA assays for diagnosis of Neisseria gonorrhoeae in Russia. APMIS 2008; 116: 133–138.

Domeika M, Savicheva A, Sokolovskiy E, Ballard R, Unemo M. Quality enhancements and quality assurance of laboratory diagnosis of sexually transmitted infections in Eastern Europe. Int J STD AIDS 2009; 20: 365–367.

Savicheva A, Sokolovsky E, Frigo N, Priputnevich T, Brilene T, Deak J, et al. Guidelines for laboratory diagnosis of Neisseria gonorrhoeae in East-European countries. Part 1: gonorrhoea, sampling, and microscopy for diagnosis. Acta Medica Lituanica 2007; 4: 65–74.

Savicheva A, Sokolovsky E, Frigo N, Priputnevich T, Brilene T, Deak J, et al. Guidelines for laboratory diagnosis of Neisseria gonorrhoeae in East-European countries. Part 2: culture, non-culture methods, determination of antibiotic resistance, and quality assurance. Acta Medica Lituanica 2007; 4: 123–134.

Sokolovskiy E, Frigo N, Rotanov S, Savicheva A, Dolia O, Kitajeva N, et al. Guidelines for the laboratory diagnosis of syphilis in East-European countries. J Eur Acad Dermatol Venereol 2009; 23: 623–632.

Domeika M, Savicheva A, Sokolovskiy E, Frigo N, Brilene T, Hallén A, et al. Guidelines for the laboratory diagnosis of Chlamydia trachomatis infections in East-European countries. J Eur Acad Dermatol Venereol 2009; 3:1353–1363.

Domeika M, Savicheva A, Sokolovskiy E, Ballard R, Unemo M; Eastern European Network for Sexual and Reproductive Health (EE SRH Network). Guidelines for laboratory diagnosis of Neisseria gonorrhoeae infections in Eastern European countries – results of an international collaboration. Euro Surveill 2007; 12: E071206.3.

Domeika M, Unemo M, Ballard RC; Eastern European Network for Sexual and Reproductive Health (EE SRH Network). Laboratory support for the diagnosis and surveillance of sexually transmitted infections (STIs) in Eastern Europe. Euro Surveill 2009; 14: pii19340.

Uno M, Deguchi T, Komeda H. Mycoplasma genitalium in the cervices of Japanese women. Sex Transm Dis 1997; 24: 284–286.

Manhart LE, Critchlow CW, Holmes KK. Mucopurulent cervicitis and Mycoplasma genitalium. J Inf Dis 2003; 187: 650–657.

Falk L, Fredlund H, Jensen JS. Signs and symptoms of urethritis and cervicitis among women with or without Mycoplasma genitalium or Chlamydia trachomatis infection. Sex Transm Infect 2005; 81: 73–78.

Anagrius C, Loré B, Jensen JS. Mycoplasma genitalium: prevalence, clinical significance, and transmission. Sex Transm Infect 2005; 81: 458–462.

Haggerty CL. Evidence for a role of Mycoplasma genitalium in pelvic inflammatory disease. Curr Opin Infect Dis 2008; 21: 65–69.

Krieger JN, Riley DE, Roberts MC, Berger RE. Prokaryotic DNA sequences in patients with chronic idiopathic prostatitis. J Clin Microbiol 1996; 34: 3120–3128.

Eickhoff JH, Frimodt-Møller N, Walter S, Frimodt-Møller C. A double-blind, randomized, controlled multicentre study to compare the efficacy of ciprofloxacin with pivampicillin as oral therapy for epididymitis in men over 40 years of age. Br J Urol Int 1999; 84: 827–834.

Clausen HF, Fedder J, Drasbek M. Serological investigation of Mycoplasma genitalium in infertile women. Hum Reprod 2001; 16: 1866–1874.

Svenstrup HF, Fedder J, Kristoffersen SE, Trolle B, Birkelund S, Christiansen G. Mycoplasma genitalium, Chlamydia trachomatis, and tubal factor infertility – a prospective study. Fertil Steril 2008; 90: 513–520.

Taylor-Robinson D, Gilroy CB, Horowitz S, Horowitz J. Mycoplasma genitalium in the joints of two patients with arthritis. Eur J Clin Microbiol Infect Dis 1994; 13: 1066–1069.

Tully JG, Rose DL, Baseman JB, Dallo SF, Lazzell AL, Davis CP. Mycoplasma pneumoniae and Mycoplasma genitalium mixture in synovial fluid isolate. J Clin Microbiol 1995; 33: 1851–1855.

Keane FE, Thomas BJ, Gilroy CB, Renton A, Taylor-Robinson D. The association of Mycoplasma hominis, Ureaplasma urealyticum and Mycoplasma genitalium with bacterial vaginosis: observations on heterosexual women and their male partners. Int J STD AIDS 2000; 11: 356–360.

Labbe AC, Frost E, Deslandes S, Mendonça AP, Alves AC, Pépin J. Mycoplasma genitalium is not associated with adverse outcomes of pregnancy in Guinea-Bissau. Sex Transm Infect 2002; 78: 289–291.

Oakeshott P, Hay P, Taylor-Robinson D, Hay S, Dohn B, Kerry S, et al. Prevalence of Mycoplasma genitalium in early pregnancy and the relationship between its presence and pregnancy outcome. Br J Obstet Gynaecol 2004; 111: 1464–1467.

Taylor-Robinson D, Furr PM, Hanna NF. Microbiological and serological study of non-gonococcal urethritis with special reference to Mycoplasma genitalium. Genitourin Med 1985; 61: 319–324.

Jensen JS, Hansen HT, Lind K. Isolation of Mycoplasma genitalium strains from the male urethra. J Clin Microbiol 1996; 34: 286–291.

Hamasuna R, Osada Y, Jensen JS. Isolation of Mycoplasma genitalium from first-void urine specimens by coculture with Vero cells. J Clin Microbiol 2007; 45: 847–850.

Lind K, Lindhardt BØ, Schütten BH, Blom J, Christiansen C. Serological cross-reactions between Mycoplasma genitalium and Mycoplasma pneumoniae. J Clin Microbiol 1984; 20: 1036–1043.

Wang RY, Grandinetti T, Shih JW, Weiss SH, Haley CL, Hayes MM, et al. Mycoplasma genitalium infection and host antibody immune response in patients infected by HIV, patients attending STD clinics and in healthy blood donors. FEMS Immunol Med Microbiol 1997; 19: 237–245.

Deguchi T, Gilroy CB, Taylor-Robinson D. Comparison of two PCR-based assays for detecting Mycoplasma genitalium in clinical specimens. Eur J Clin Microbiol Infect Dis 1995; 14: 629–631.

Cadieux N, Lebel P, Brousseau R. Use of a triplex polymerase chain reaction for the detection and differentiation of Mycoplasma pneumoniae and Mycoplasma genitalium in the presence of human DNA. J Gen Microbiol 1993; 139: 2431–2437.

Mena L, Wang X, Mroczkowski TF, Martin DM. Mycoplasma genitalium infections in asymptomatic men and men with urethritis attending a sexually transmitted diseases clinic in New Orleans. Clin Infect Dis 2002; 35: 1167–1173.

de Barbeyrac B, Bernet-Poggi C, Fébrer F, Renaudin H, Dupon M, Bébéar C. Detection of Mycoplasma pneumoniae and Mycoplasma genitalium in clinical samples by polymerase chain reaction. Clin Infect Dis 1993; 17: 83–89.

Totten PA, Schwartz MA, Sjöström KE, Kenny GE, Handsfield HH, Weiss JB, et al. Association of Mycoplasma genitalium with nongonococcal urethritis in heterosexual men. J Infect Dis 2001; 183: 269–276.

Jensen JS, Ørsum R, Dohn B, Uldum S, Worm AM, Lind K. Mycoplasma genitalium: a cause of male urethritis? Genitourin Med 1993; 69: 265–269.

Dutro SM, Hebb JK, Garin CA Hughes PA, Kenny GE, Totten PA. Development and performance of a microwell-plate-based polymerase chain reaction assay for Mycoplasma genitalium. Sex Transm Dis 2003; 30: 756–763.

Jensen JS, Björnelius E, Dohn B, Lidbrink P. Use of TaqMan 5’ nuclease real-time PCR for quantitative detection of Mycoplasma genitalium DNA in males with and without urethritis who were attendees at a sexually transmitted disease clinic. J Clin Microbiol 2004; 42: 683–692.

Sasaki Y, Shintani M, Shimada T, Watanabe H, Sasaki T. Detection and discrimination of Mycoplasma pneumoniae and Mycoplasma genitalium by the in vitro DNA amplification. Microbiol Immunol 1992; 36: 21–27.

Jensen JS, Borre MB, Dohn B. Detection of Mycoplasma genitalium by PCR amplification of the 16S rRNA gene. J Clin Microbiol 2003; 41: 261–266.

Ma L, Martin DH. Single-nucleotide polymorphisms in the rRNA operon and variable numbers of tandem repeats in the lipoprotein gene among Mycoplasma genitalium strains from clinical specimens. J Clin Microbiol 2004; 42: 4876–4878.

Eastick K, Leeming JP, Caul EO, Horner PJ, Millar MR. A novel polymerase chain reaction assay to detect Mycoplasma genitalium. Mol Pathol 2003; 56: 25–28.

Yoshida T, Maeda S, Deguchi T, Ishiko H. Phylogeny-based rapid identification of mycoplasmas and ureaplasmas from urethritis patients. J Clin Microbiol 2002; 40: 105–110.

Yoshida T, Maeda S, Deguchi T, Miyazawa T, Ishiko H. Rapid detection of Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma parvum, and Ureaplasma urealyticum organisms in genitourinary samples by PCR-microtiter plate hybridization assay. J Clin Microbiol 2003; 41: 1850–1855.

Yoshida T, Deguchi T, Ito M, Maeda S, Tamaki M, Ishiko H. Quantitative detection of Mycoplasma genitalium from first-pass urine of men with urethritis and asymptomatic men by real-time PCR. J Clin Microbiol 2002; 40: 1451–1455.

Jurstrand M, Jensen JS, Fredlund H, Falk L, Mölling P. Detection of Mycoplasma genitalium in urogenital specimens by real-time PCR and by conventional PCR assay. J Med Microbiol 2005; 54: 23–29.

Dupin N, Bijaoui G, Schwarzinger M, Ernault P, Gerhardt P, Jdid R, et al. Detection and quantification of Mycoplasma genitalium in male patients with urethritis. Clin Infect Dis 2003; 37: 602–605.

Svenstrup HF, Jensen JS, Björnelius E, Lidbrink P, Birkelund S, Christiansen G. Development of a quantitative real-time PCR assay for detection of Mycoplasma genitalium. J Clin Microbiol 2005; 43: 3121–3128.

Hamasuna R, Imai H, Tukino H, Jensen JS, Osada Y. Prevalence of Mycoplasma genitalium among female students in vocational schools of Japan. Sex Transm Infect 2008; 84: 303–305.

Wroblewski JK, Manhart LE, Dickey KA, Hudspeth MK, Totten PA. Comparison of transcription-mediated amplification and PCR assay results for various genital specimen types for detection of Mycoplasma genitalium. J Clin Microbiol 2006; 44: 3306–3312.

Kievits T, van Gemen B, van Strijp D, Schukkink R, Dircks M, Adriaanse H, et al. NASBA isothermal enzymatic in vitro nucleic acid amplification optimized for the diagnosis of HIV-1 infection. J Virol Methods 1991; 35: 273–286.

Wikström A, Jensen JS. Mycoplasma genitalium: a common cause of persistent urethritis among men treated with doxycycline. Sex Transm Infect 2006; 82: 276–279.

Ross JDC, Jensen JS. Mycoplasma genitalium as a sexually transmitted infection: implications for screening, testing, and treatment. Sex Transm Infect 2006; 82: 269–271.

Jensen JS, Björnelius E, Dohn B, Lidbrink P. Comparison of first void urine and urogenital swab specimens for detection of Mycoplasma genitalium and Chlamydia trachomatis by polymerase chain reaction in patients attending a sexually transmitted disease clinic. Sex Transm Dis 2004; 31: 499–507.

Edberg A, Aronsson F, Johansson E, Wikander E, Ahlqvist T, Fredlund H. Endocervical swabs transported in first void urine as combined specimens in the detection of Mycoplasma genitalium by real-time PCR. J Med Microbiol 2009; 58: 117–120.

Shipitsyna E, Zolotoverkhaya E, Dohn B, Benkovich A, Savicheva A, Sokolovsky E, et al. First evaluation of polymerase chain reaction (PCR) assays used for diagnosis of Mycoplasma genitalium in Russia. J Eur Acad Dermatol Venereol 2009; 23: 1164–1172.

Banoo S, Bell D, Bossuyt P, Herring A, Mabey D, Poole F, et al. TDR Diagnostics Evaluation Expert Panel. Evaluation of diagnostic tests for infectious diseases: general principles. Nat Rev Microbiol 2006; 4 (12 Suppl): S20–32.

Peeling RW, Smith PG, Bossuyt PMM. A guide for diagnostic evaluations. Nat Rev Microbiol 2006; 4 (12 Suppl): S2–6.

Shipitsyna E, Zolotoverkhaya E, Agné-Stadling I, Krysanova A, Savicheva A, Sokolovsky E, et al. First evaluation of six nucleic acid amplification tests widely used in the diagnosis of Chlamydia trachomatis in Russia. J Eur Acad Dermatol Venereol 2009; 23: 268–276.

Shipitsyna E, Zolotoverkhaya E, Hjelmevoll SO, Maximova A, Savicheva A, Sokolovsky E, et al. Evaluation of six nucleic acid amplification tests used for diagnosis of Neisseria gonorrhoeae in Russia to an international strictly validated real-time porA pseudogene PCR. J Eur Acad Dermatol Venereol 2009; 23: 1246–1253.

Special Report

Guidelines for the Laboratory Diagnosis of Mycoplasma genitalium Infections in East European Countries